Example 1: Experimental validated non-specific amplicons predicted by MFEprimer

We have designed a primer pair, 5’-GATGAAGGCGTCTGAGGA-3’ and 5’-GATCTTGTGCTTGGTGGC-3’, to amplify the human myoglobin gene (GeneID: 4151). There are three variants of the human gene myoglobin gene: NM_203377.1, NM_005368.2 and NM_203378.1 (Fig. 1). Multiple alignment by T-coffee (Notredame, et al., 2000) showed that the three variants are largely conserved. The abovementioned primers are located in the conservative region (sequence fragment in yellow is for the forward primer, while the green one for the reverse primer). The question is to evaluate the primers specificity using various programs to see which program is the best for predicting non-specific amplicons.

Fig. 1. Diagram showing the three variants of human myoglobin gene.

1.   NCBI BLAST for short nearly exact matches

Following the NCBI BLAST program selection guide for short nearly exact matches (http://www.ncbi.nlm.nih.gov/blast/producttable.shtml#shortn), we run a normal NCBI-Blast search with following parameters.

 

Query: GATGAAGGCGTCTGAGGANNNNNNNNNNNNNNNNNNNGATCTTGTGCTTGGTGGC

Database: human.rna.fna (from ftp://ftp.ncbi.nlm.nih.gov) Date: Aug 17, 2008 Version: 4

Other parameters: -W 7 –e 1000 –F F –b 500

 

The Blast results showed that this primer set is good enough for PCR reaction, but no any other non-specific amplicons are predicted (Fig. 2). In other words, this primer set would successfully amplify all of the three variants of human myoglobin gene at the same time.

Fig. 2. Evaluating the primer set for human myoglobin gene by NCBI BLAST for short nearly exact matches. The yellow line indicates two HSPs hit the same gene. In other words, the eight yellow lines showed the primer pair may result eight amplicons. However, except for the top three hits, others could not be obtained in the real PCR reaction. The reason is that the last three resides at 3’ end of primer should match exactly (Rychlik, 1995). In short, the result here showed that the primer set is good enough for amplifying human myoglobin gene but not for other non-specific amplicons.

2.   Primer-BLAST

The NCBI staff recently released a server for primer design, named Primer-BLAST. It can also check the primers specificity to the DNA template. For evaluating the abovementioned primer set for human myoglobin gene, the parameters of Primer-BLAST are: Min of product size is 100; database is Homo sapiens RefSeq mRNA. Results showed that this primer set is good enough for amplifying human myoglobin gene but not for other non-specific amplicons (Fig. 3).

Fig. 3. Evaluating the primer set for human myoglobin gene by Primer-BLAST. No any non-specific amplicons other than the three variants of human myoglobin gene were predicted.

3.   VPCR 2.0 did not work for this primer set because of the human cDNA/RefSeq or Genome database was unavailable in the VPCR web server.

4.   PRIMEX did not work

The server said “Error found: The requested URL /home/mateo/primex_cgi/primex_client.cgi was not found on this server.”

5.   PUNS

Database: Human Genomic

Other parameters: Default

Results: No amplicons found.

6.   GenomeTester

LEFT: GATGAAGGCGTCTGAGGA

RIGHT: GATCTTGTGCTTGGTGGC

Database: Homo Sapiens build NCBI 36 (Oct 2005)

The results show that the primer pair is good (Fig. 4).

Fig. 4. Evaluating the primer set for human myoglobin gene by GenomeTester. One amplicon was found in the genome region. The result shows that the primer set is good. However, there is no any mRNA/cDNA database available to evaluate the non-specific amplicons for the transcripts.

7.   MFEprimer

Database: Human RefSeq mRNA

Word size: 10

Other parameters: Default

 

Results show that there are two potential non-specific amplicons with size of 198 bp and 232 bp close to that of the specific amplicon (136 bp). However, based on the Tm differences between specific and non-specific amplicons, these non-specific amplicons can be avoided by using higher annealing temperature (Fig. 5).

 

A

 

B

Fig. 5. Evaluating the primer set for human myoglobin gene by MFEprimer. This primer set may result in 12 potential amplicons. The potential amplicons 1-3 are the expected or specific amplicons, while 4-7 and 10-12 are two non-specific amplicons because their sizes (198 bp, 232 bp) are close to 136 bp. The potential amplicons 8 and 9 may also compete with other products but the sizes are quite longer. However, these non-specific amplicons can be avoided by using higher annealing temperature. A: Binding pattern of the abovementioned primer set with the human myoglobin gene for a specific PCR reaction; B: Binding pattern of the abovementioned primer set with the human NUMB gene for a typical non-specific PCR reaction.

8.   Experimental results

We have used this primer set to amplify the cDNA samples isolated from the cultured HEK293 cells by PCR. Surprisingly, there are two distinctive bands obtained between 100 bp and 250 bp separated with 1.5% agarose gel (data not shown). After direct sequencing analysis of these two bands, we found that one of the band is human myoglobin gene of 136 bp in size as expected, however, the other is the Homo sapiens numb homolog (Drosophila) (NUMB) gene (GeneID: 8650) of 198 bp in size (Fig. 6).

 

A

 

B.

 

C.

Fig. 6. Diagram showing that the amplicon of 198 bp is the Homo sapiens numb homolog (Drosophila) (NUMB), transcript variant 4, mRNA, analyzed by the Sequencher™ software (Gene Codes Corporation, USA). Clearly, the 198 bp amplicon is from a typical non-specific PCR amplification. A: Distribution patterns of the primer set for human myoglobin binding to the Homo sapiens numb homolog (Drosophila) (NUMB) gene; B: Binding pattern of the forward primer with the NUMB gene; C: Binding pattern of the reverse primer with the NUMB gene.

9.   Conclusion

The primer set we designed has passed all the tests of other programs except MFEprimer. The results of MFEprimer for this primer pair indicated that there are two non-specific amplicons with sizes close to the size of expected/specific amplicon. Based on the results of direct DNA sequencing analysis, the non-specific amplicon of 198 was identified. It is clear that only MFEprimer successfully predicted this potential amplicon. In other words, if the user uses MFEprimer to run a virtually PCR reaction before the real experiment, this non-specific primer set should be discarded. Otherwise, the user needs to modify the PCR conditions to suppress non-specific amplifications, for example, by using higher annealing temperature.

 

Example 2: MFEprimer is able to identify errors in the primer-pairs of the AtRTPrimer database

AtRTPrimer is a database for Arabidopsis genome-wide homogeneous and specific RT-PCR primer-pairs by Han and Kim (Han and Kim, 2006). To evaluate the reliability of the database, the authors selected primer pairs from 15 genes using conventional and real time RT-PCR. Fig. 7 was the results and the following is the explanation for the unexpected amplicons by the authors.

“Those unexpected amplicons including the very weak ones from cDNA were observed in lane 1, 7, 8, 13 and 15 of RT-PCR (Figure 3-A). In 1, 7, 8 and 15, it is difficult to observe those unexpected bands in naked eye, while it is clear in 13. Although we did not confirm those amplicons by DNA sequencing, we believe that it was from unknown alternative splicing forms. The first reason is that there is not the same size of amplicon from gDNA. Second, In TIGR database, there are only 2,000 genes having alternative splicing variants so far. Therefore, AtRTPrimer can not predict those kinds of amplicons if target gene's splicing forms are unknown. A researcher should test a target gene before real experiments to overcome this type of error. In addition, each amplicon in lane 11 and 12 has the same size of amplicon from gDNA as shown in genomic DNA PCR (Figure 3-A). Therefore, we believe that those bands are the amplicons of the contaminated genomic DNA.” (Han and Kim, 2006).

Fig. 7. The 15 genes evaluated by conventional RT-PCR and genomic PCR (Han and Kim, 2006)

 

To evaluate the performance of MFEprimer, we use the stand-alone version to determine whether there are errors in these primer pairs provided by the AtRTPrimer database (Fig. 7B). After analysis with MFEprimer, it is clear that there are some errors in the primer pair for the gene No. 6 because AtRTPrimer failed to predict another amplicon with the same size of 354 bp. More importantly, the AtRTPrimer also failed to identify the amplicon of 576 bp with the primer pair for the gene No. 11 but only reported the 343 bp for the cDNA/mRNA amplification. However, MFEprimer predicted both the 343 bp and 576 bp size amplicons by the primer set for the gene No. 11. According to which, the two distinct bands in lane 11 of Fig. 3A are two splicing isoforms of the same gene (see below for details of the alignment with T-COFFEE ). It is thus clear that MFEprimer is able to help user to check the primer set to select more suitable primer set(s) for successful PCR reactions.

 

List of the predicted amplicons by MFEprimer

for the 15 genes in the AtRTPrimer database

 

MFEprimer 1.1 [Apr-24-2008]

 

BLASTN 2.2.18 [Mar-02-2008]

Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,  Jinghui

Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),  "Gapped

BLAST and PSI-BLAST: a new generation of protein database search

programs",  Nucleic Acids Res. 25:3389-3402.

 

 

Query = pFwd_Gene_1; pRvs_Gene_1;

        (2 primer sequences; 47 letters)

 

Database: Arabidopsis_thaliana.rna

           33,910 sequences; 49,561,067 total letters

 

Searching..................................................done

 

 

Distribution of 9 MFEprimer hits on the query primer sequences

 

[Sort by primer pair coverage (PPC)]

                                                                                       FP    RP      FP    RP

                                                                     Size      PPC    3'ΔG  3'ΔG   Tm    Tm

Sequences producing potential PCR products:                          (bp)      (%)    (kcal/mol)    (°C)  (°C)

 

1: ref|NM_179211.2| Arabidopsis thaliana FCA...                      300      91.0    -2.3   -3.4   65.0  65.6

2: ref|NM_117725.3| Arabidopsis thaliana FCA...                      300      91.0    -2.3   -3.4   65.0  65.6

3: ref|NM_179212.3| Arabidopsis thaliana FCA...                      300      91.0    -2.3   -3.4   65.0  65.6

4: ref|NM_179211.2| Arabidopsis thaliana FCA...                      2484     -37.6   -3.4   -3.4   40.2  65.6

5: ref|NM_113399.2| Arabidopsis thaliana DNA...                      447      19.5    -2.3   -3.4   34.2  31.5

6: ref|NM_113400.3| Arabidopsis thaliana DNA...                      447      19.5    -2.3   -3.4   34.2  31.5

7: ref|NM_113400.3| Arabidopsis thaliana DNA...                      453      19.5    -2.3   -3.4   34.2  31.5

8: ref|NM_123078.2| Arabidopsis thaliana CIP...                      2275     -17.8   -3.4   -3.4   27.3  27.0

9: ref|NM_105521.3| Arabidopsis thaliana unk...                      54       -17.2   -3.4   -3.4   31.5  27.3

……

 

 

Query = pFwd_Gene_2; pRvs_Gene_2;

        (2 primer sequences; 48 letters)

 

Database: Arabidopsis_thaliana.rna

           33,910 sequences; 49,561,067 total letters

 

Searching..................................................done

 

 

Distribution of 4 MFEprimer hits on the query primer sequences

 

[Sort by primer pair coverage (PPC)]

                                                                                       FP    RP      FP    RP

                                                                     Size      PPC    3'ΔG  3'ΔG   Tm    Tm

Sequences producing potential PCR products:                          (bp)      (%)    (kcal/mol)    (°C)  (°C)

 

1: ref|NM_121351.4| Arabidopsis thaliana FY ...                      448      94.1    -2.4   -1.8   62.7  63.9

2: ref|NM_102748.1| Arabidopsis thaliana kel...                      971      -22.9   -1.8   -1.8   28.1  28.1

3: ref|NM_202587.1| Arabidopsis thaliana HEM...                      433      -19.8   -1.8   -1.8   23.5  22.1

4: ref|NM_180256.1| Arabidopsis thaliana HEM...                      433      -19.8   -1.8   -1.8   23.5  22.1

5: ref|NM_112355.2| Arabidopsis thaliana HEM...                      433      -19.8   -1.8   -1.8   23.5  22.1

……

 

Query = pFwd_Gene_3; pRvs_Gene_3;

        (2 primer sequences; 48 letters)

 

Database: Arabidopsis_thaliana.rna

           33,910 sequences; 49,561,067 total letters

 

Searching..................................................done

 

 

Distribution of 2 MFEprimer hits on the query primer sequences

 

[Sort by primer pair coverage (PPC)]

                                                                                       FP    RP      FP    RP

                                                                     Size      PPC    3'ΔG  3'ΔG   Tm    Tm

Sequences producing potential PCR products:                          (bp)      (%)    (kcal/mol)    (°C)  (°C)

 

1: ref|NM_116490.3| Arabidopsis thaliana LD ...                      310      94.1    -3.1   -3.1   63.1  62.8

2: ref|NM_120926.2| Arabidopsis thaliana lip...                      840      -15.3   -3.1   -3.1   17.3  17.3

3: ref|NM_105476.4| Arabidopsis thaliana ATM...                      579      -13.6   -3.1   -3.1   19.6  22.3

4: ref|NM_148326.2| Arabidopsis thaliana ATP...                      2179     -13.0   -3.1   -3.1   10.3  28.0

……

 

 

Query = pRvs_Gene_4; pFwd_Gene_4;

        (2 primer sequences; 45 letters)

 

Database: Arabidopsis_thaliana.rna

           33,910 sequences; 49,561,067 total letters

 

Searching..................................................done

 

 

Distribution of 1 MFEprimer hits on the query primer sequences

 

[Sort by primer pair coverage (PPC)]

                                                                                       FP    RP      FP    RP

                                                                     Size      PPC    3'ΔG  3'ΔG   Tm    Tm

Sequences producing potential PCR products:                          (bp)      (%)    (kcal/mol)    (°C)  (°C)

 

1: ref|NM_127510.4| Arabidopsis thaliana FVE...                      394      96.9    -1.7   -3.6   62.4  62.5

2: ref|NM_130045.3| Arabidopsis thaliana DAD...                      572      -18.9   -3.6   -3.6   28.9  28.9

3: ref|NM_101260.2| Arabidopsis thaliana unk...                      1177     -17.2   -1.7   -1.7   27.7  17.2

4: ref|NM_115466.3| Arabidopsis thaliana deh...                      298      -16.7   -1.7   -1.7   17.2  17.2

5: ref|NM_120694.2| Arabidopsis thaliana Ran...                      1636     -16.7   -1.7   -1.7   17.2  17.2

……

 

 

Query = pRvs_Gene_5; pFwd_Gene_5;

        (2 primer sequences; 48 letters)

 

Database: Arabidopsis_thaliana.rna

           33,910 sequences; 49,561,067 total letters

 

Searching..................................................done

 

 

Distribution of 7 MFEprimer hits on the query primer sequences

 

[Sort by primer pair coverage (PPC)]

                                                                                       FP    RP      FP    RP

                                                                     Size      PPC    3'ΔG  3'ΔG   Tm    Tm

Sequences producing potential PCR products:                          (bp)      (%)    (kcal/mol)    (°C)  (°C)

 

1: ref|NM_116290.2| Arabidopsis thaliana FRI...                      401      94.1    -2.1   -2.3   63.4  64.7

2: ref|NM_124922.1| Arabidopsis thaliana fim...                      1311     -16.7   -2.1   -2.1   14.2  25.2

3: ref|NR_023046.1| Arabidopsis thaliana (AT...                      180      -13.8   -2.1   -2.1   8.0   21.1

4: ref|NM_118914.2| Arabidopsis thaliana ISI...                      506      -13.6   -2.1   -2.1   9.2   8.0

……

 

 

Query = pFwd_Gene_6; pRvs_Gene_6; [Error in AtRTPrimer: Lack of another amplicon of 354 bp]

        (2 primer sequences; 47 letters)

 

Database: Arabidopsis_thaliana.rna

           33,910 sequences; 49,561,067 total letters

 

Searching..................................................done

 

 

Distribution of 2 MFEprimer hits on the query primer sequences

 

[Sort by primer pair coverage (PPC)]

                                                                                       FP    RP      FP    RP

                                                                     Size      PPC    3'ΔG  3'ΔG   Tm    Tm

Sequences producing potential PCR products:                          (bp)      (%)    (kcal/mol)    (°C)  (°C)

 

1: ref|NM_001085094.1| Arabidopsis thaliana ...                      354      97.0    -3.3   -3.3   63.7  63.6

2: ref|NM_121052.2| Arabidopsis thaliana FLC...                      354      97.0    -3.3   -3.3   63.7  63.6

3: ref|NM_180653.2| Arabidopsis thaliana hea...                      1531     -12.5   -3.3   -3.3   19.6  30.6

4: ref|NM_106641.3| Arabidopsis thaliana hea...                      1531     -12.5   -3.3   -3.3   19.6  30.6

5: ref|NM_106642.4| Arabidopsis thaliana HSP...                      1532     -12.5   -3.3   -3.3   19.6  30.6

6: ref|NM_001036228.2| Arabidopsis thaliana ...                      1532     -12.5   -3.3   -3.3   19.6  30.6

7: ref|NM_106642.4| Arabidopsis thaliana HSP...                      1638     -12.5   -3.3   -3.3   19.6  30.6

8: ref|NM_001036228.2| Arabidopsis thaliana ...                      1638     -12.5   -3.3   -3.3   19.6  30.6

……

 

 

Query = pRvs_Gene_7; pFwd_Gene_7;

        (2 primer sequences; 46 letters)

 

Database: Arabidopsis_thaliana.rna

           33,910 sequences; 49,561,067 total letters

 

Searching..................................................done

 

 

Distribution of 1 MFEprimer hits on the query primer sequences

 

[Sort by primer pair coverage (PPC)]

                                                                                       FP    RP      FP    RP

                                                                     Size      PPC    3'ΔG  3'ΔG   Tm    Tm

Sequences producing potential PCR products:                          (bp)      (%)    (kcal/mol)    (°C)  (°C)

 

1: ref|NM_112785.4| Arabidopsis thaliana VRN...                      350      100.0   -1.0   -2.6   63.9  63.8

2: ref|NM_118824.3| Arabidopsis thaliana AT-...                      370      19.4    -1.0   -2.6   24.7  33.2

3: ref|NM_104475.2| Arabidopsis thaliana ATH...                      845      15.7    -1.0   -2.6   19.4  23.3

4: ref|NM_130311.2| Arabidopsis thaliana CKI...                      935      -15.7   -1.0   -1.0   11.6  19.4

……

 

 

Query = pRvs_Gene_8; pFwd_Gene_8;

        (2 primer sequences; 50 letters)

 

Database: Arabidopsis_thaliana.rna

           33,910 sequences; 49,561,067 total letters

 

Searching..................................................done

 

 

Distribution of 4 MFEprimer hits on the query primer sequences

 

[Sort by primer pair coverage (PPC)]

                                                                                       FP    RP      FP    RP

                                                                     Size      PPC    3'ΔG  3'ΔG   Tm    Tm

Sequences producing potential PCR products:                          (bp)      (%)    (kcal/mol)    (°C)  (°C)

 

1: ref|NM_202834.2| Arabidopsis thaliana VRN...                      300      100.0   -2.1   -1.2   63.2  63.4

2: ref|NM_117787.3| Arabidopsis thaliana VRN...                      300      100.0   -2.1   -1.2   63.2  63.4

3: ref|NM_104735.3| Arabidopsis thaliana ATV...                      906      16.0    -2.1   -1.2   23.4  18.6

4: ref|NM_100049.3| Arabidopsis thaliana U-b...                      1045     13.6    -1.2   -2.1   8.6   17.0

5: ref|NM_118080.2| Arabidopsis thaliana CYC...                      410      -13.3   -2.1   -2.1   23.4  17.0

6: ref|NM_122383.4| Arabidopsis thaliana unk...                      4694     -13.3   -2.1   -2.1   23.4  17.0

……

 

 

Query = pFwd_Gene_9; pRvs_Gene_9;

        (2 primer sequences; 47 letters)

 

Database: Arabidopsis_thaliana.rna

           33,910 sequences; 49,561,067 total letters

 

Searching..................................................done

 

 

Distribution of 2 MFEprimer hits on the query primer sequences

 

[Sort by primer pair coverage (PPC)]

                                                                                       FP    RP      FP    RP

                                                                     Size      PPC    3'ΔG  3'ΔG   Tm    Tm

Sequences producing potential PCR products:                          (bp)      (%)    (kcal/mol)    (°C)  (°C)

 

1: ref|NM_179295.2| Arabidopsis thaliana PAP...                      355      97.0    -1.0   -3.4   65.2  64.7

2: ref|NM_100824.2| Arabidopsis thaliana PAP...                      355      97.0    -1.0   -3.4   65.2  64.7

3: ref|NM_100361.3| Arabidopsis thaliana Rab...                      76       -15.7   -3.4   -3.4   29.6  21.6

4: ref|NM_180914.1| Arabidopsis thaliana unk...                      529      15.6    -1.0   -3.4   14.2  37.8

5: ref|NM_125602.2| Arabidopsis thaliana unk...                      529      15.6    -1.0   -3.4   14.2  37.8

6: ref|NM_147991.1| Arabidopsis thaliana unk...                      513      15.6    -3.4   -1.0   32.9  14.2

……

 

 

Query = pRvs_Gene_10; pFwd_Gene_10;

        (2 primer sequences; 49 letters)

 

Database: Arabidopsis_thaliana.rna

           33,910 sequences; 49,561,067 total letters

 

Searching..................................................done

 

 

Distribution of 1 MFEprimer hits on the query primer sequences

 

[Sort by primer pair coverage (PPC)]

                                                                                       FP    RP      FP    RP

                                                                     Size      PPC    3'ΔG  3'ΔG   Tm    Tm

Sequences producing potential PCR products:                          (bp)      (%)    (kcal/mol)    (°C)  (°C)

 

1: ref|NM_102124.2| Arabidopsis thaliana GI ...                      304      97.1    -3.5   -2.0   64.8  64.7

2: ref|NM_125462.3| Arabidopsis thaliana REV...                      89       -11.5   -2.0   -2.0   16.1  5.5

3: ref|NM_114754.1| Arabidopsis thaliana gly...                      398      -11.5   -2.0   -2.0   16.1  5.5

4: ref|NM_122192.1| Arabidopsis thaliana har...                      460      -11.1   -2.0   -2.0   5.5   5.5

5: ref|NM_125462.3| Arabidopsis thaliana REV...                      2251     11.0    -3.5   -2.0   23.6  5.5

……

 

 

Query = pRvs_Gene_11; pFwd_Gene_11; [Error in AtRTPrimer: Lack of another amplicon of 576 bp]

        (2 primer sequences; 47 letters)

 

Database: Arabidopsis_thaliana.rna

           33,910 sequences; 49,561,067 total letters

 

Searching..................................................done

 

 

Distribution of 9 MFEprimer hits on the query primer sequences

 

[Sort by primer pair coverage (PPC)]

                                                                                       FP    RP      FP    RP

                                                                     Size      PPC    3'ΔG  3'ΔG   Tm    Tm

Sequences producing potential PCR products:                          (bp)      (%)    (kcal/mol)    (°C)  (°C)

 

1: ref|NM_121589.1| Arabidopsis thaliana CO ...                      343      91.0    -2.7   -2.6   64.6  64.5

2: ref|NM_001036810.1| Arabidopsis thaliana ...                      576      91.0    -2.7   -2.6   64.6  64.5

3: ref|NM_123848.2| Arabidopsis thaliana CHR...                      206      -21.2   -2.6   -2.6   23.3  30.7

4: ref|NM_119372.2| Arabidopsis thaliana ASY...                      209      -21.2   -2.6   -2.6   23.3  14.2

5: ref|NM_130116.3| Arabidopsis thaliana WD-...                      1477     -21.2   -2.6   -2.6   23.3  30.7

6: ref|NM_111012.3| Arabidopsis thaliana MBD...                      3190     19.6    -2.7   -2.6   20.5  29.0

7: ref|NM_113538.1| Arabidopsis thaliana CYP...                      1070     18.2    -2.6   -2.7   23.3  20.5

……

 

Comparing the amplicons of 343 bp and 576 bp below with the T-COFFEE program:

 

CLUSTAL FORMAT for T-COFFEE Version_7.04 [http://www.tcoffee.org] [MODE:  ], CPU=0.36 sec, SCORE=99, Nseq=2, Len=576

 

343bp_NM_121589.1     TCGTGGCTGTTCCCTAATTCAGACAaaaataacaataaccaaaacaatgggttattgttt

576bp_NM_001036810.1  TCGTGGCTGTTCCCTAATTCAGACAaaaataacaataaccaaaacaatgggttattgttt

                      ************************************************************

 

343bp_NM_121589.1     agtgatgagtatctaaaccttgtggattacaactcgagtatggactacaaattcacaggt

576bp_NM_001036810.1  agtgatgagtatctaaaccttgtggattacaactcgagtatggactacaaattcacaggt

                      ************************************************************

 

343bp_NM_121589.1     gaatacagtcaacaccaacaaaactgcagcgtaccacagacgagctacgggggagataga

576bp_NM_001036810.1  gaatacagtcaacaccaacaaaactgcagcgtaccacagacgagctacgggggagataga

                      ************************************************************

 

343bp_NM_121589.1     gttgttccgcttaaacttgaagaatcaaggggccaccagtgccataaccaacagaatttt

576bp_NM_001036810.1  gttgttccgcttaaacttgaagaatcaaggggccaccagtgccataaccaacagaatttt

                      ************************************************************

 

343bp_NM_121589.1     cagttcaatatcaaatatggctcctcagggactcactacaacgacaatggttccattaac

576bp_NM_001036810.1  cagttcaatatcaaatatggctcctcagggactcactacaacgacaatggttccattaac

                      ************************************************************

 

343bp_NM_121589.1     cataacg-----------------------------------------------------

576bp_NM_001036810.1  cataacgtaaggcttttgtatatttgttaccccttcaatttagcatcttcccataacgca

                      *******                                                    

 

343bp_NM_121589.1     ------------------------------------------------------------

576bp_NM_001036810.1  gcagggtgaattctttcatcatacacacaaatccactgatccactgccaacagttgatct

                                                                                 

 

343bp_NM_121589.1     ------------------------------------------------------------

576bp_NM_001036810.1  atagcacatagaaatttcaccagaagtctataataaaaacaatatatgcttccttttgca

                                                                                 

 

343bp_NM_121589.1     ------------------------------------------------------------

576bp_NM_001036810.1  tcgactctctttagtcctcttaccagggggattgagaatgtctttgtttctgtcattagg

                                                                                 

 

343bp_NM_121589.1     catacatttcatccATGGAAACTGGTGTTGTGCCGG

576bp_NM_001036810.1  catacatttcatccATGGAAACTGGTGTTGTGCCGG

                      ************************************

 

 

 

Query = pFwd_Gene_12; pRvs_Gene_12;

        (2 primer sequences; 49 letters)

 

Database: Arabidopsis_thaliana.rna

           33,910 sequences; 49,561,067 total letters

 

Searching..................................................done

 

 

Distribution of 1 MFEprimer hits on the query primer sequences

 

[Sort by primer pair coverage (PPC)]

                                                                                       FP    RP      FP    RP

                                                                     Size      PPC    3'ΔG  3'ΔG   Tm    Tm

Sequences producing potential PCR products:                          (bp)      (%)    (kcal/mol)    (°C)  (°C)

 

1: ref|NM_105222.2| Arabidopsis thaliana FT ...                      366      97.1    -2.8   -3.4   64.8  64.6

2: ref|NM_118515.3| Arabidopsis thaliana leu...                      1342     14.2    -3.4   -2.8   32.0  16.4

3: ref|NM_124983.3| Arabidopsis thaliana HSP...                      167      -13.3   -2.8   -2.8   23.9  16.4

4: ref|NM_124982.2| Arabidopsis thaliana hea...                      167      -13.3   -2.8   -2.8   23.9  16.4

5: ref|NM_124985.4| Arabidopsis thaliana HSP...                      167      -13.0   -2.8   -2.8   16.4  16.4

6: ref|NM_179310.2| Arabidopsis thaliana ATR...                      517      -13.0   -2.8   -2.8   16.4  16.4

7: ref|NM_101037.3| Arabidopsis thaliana ATR...                      517      -13.0   -2.8   -2.8   16.4  16.4

……

 

 

Query = pRvs_Gene_13; pFwd_Gene_13;

        (2 primer sequences; 50 letters)

 

Database: Arabidopsis_thaliana.rna

           33,910 sequences; 49,561,067 total letters

 

Searching..................................................done

 

 

Distribution of 2 MFEprimer hits on the query primer sequences

 

[Sort by primer pair coverage (PPC)]

                                                                                       FP    RP      FP    RP

                                                                     Size      PPC    3'ΔG  3'ΔG   Tm    Tm

Sequences producing potential PCR products:                          (bp)      (%)    (kcal/mol)    (°C)  (°C)

 

1: ref|NM_130128.3| Arabidopsis thaliana AGL...                      359      100.0   -2.0   -1.6   64.6  63.0

2: ref|NM_117606.5| Arabidopsis thaliana unk...                      94       13.8    -2.0   -1.6   10.6  17.5

3: ref|NM_106594.3| Arabidopsis thaliana GA2...                      1475     -13.3   -1.6   -1.6   17.5  25.9

4: ref|NM_126244.2| Arabidopsis thaliana WOL...                      2607     -13.3   -1.6   -1.6   17.5  25.9

5: ref|NM_179594.1| Arabidopsis thaliana WOL...                      2607     -13.3   -1.6   -1.6   17.5  25.9

6: ref|NM_201667.1| Arabidopsis thaliana WOL...                      2607     -13.3   -1.6   -1.6   17.5  25.9

……

 

 

Query = pFwd_Gene_14; pRvs_Gene_14;

        (2 primer sequences; 50 letters)

 

Database: Arabidopsis_thaliana.rna

           33,910 sequences; 49,561,067 total letters

 

Searching..................................................done

 

 

Distribution of 5 MFEprimer hits on the query primer sequences

 

[Sort by primer pair coverage (PPC)]

                                                                                       FP    RP      FP    RP

                                                                     Size      PPC    3'ΔG  3'ΔG   Tm    Tm

Sequences producing potential PCR products:                          (bp)      (%)    (kcal/mol)    (°C)  (°C)

 

1: ref|NM_125579.1| Arabidopsis thaliana LFY...                      345      100.0   -3.1   -2.3   66.3  63.5

2: ref|NM_100470.4| Arabidopsis thaliana zin...                      537      -16.4   -2.3   -2.3   26.5  30.6

3: ref|NM_105563.4| Arabidopsis thaliana 2-o...                      100      -13.6   -2.3   -2.3   20.2  30.6

4: ref|NM_123479.3| Arabidopsis thaliana unk...                      1962     13.6    -3.1   -2.3   21.1  23.5

5: ref|NM_101924.2| Arabidopsis thaliana hel...                      959      13.3    -3.1   -2.3   24.5  20.2

6: ref|NM_102531.3| Arabidopsis thaliana eth...                      1152     -13.3   -2.3   -2.3   26.5  20.2

……

 

 

Query = pFwd_Gene_15; pRvs_Gene_15;

        (2 primer sequences; 49 letters)

 

Database: Arabidopsis_thaliana.rna

           33,910 sequences; 49,561,067 total letters

 

Searching..................................................done

 

 

Distribution of 2 MFEprimer hits on the query primer sequences

 

[Sort by primer pair coverage (PPC)]

                                                                                       FP    RP      FP    RP

                                                                     Size      PPC    3'ΔG  3'ΔG   Tm    Tm

Sequences producing potential PCR products:                          (bp)      (%)    (kcal/mol)    (°C)  (°C)

 

1: ref|NM_105581.2| Arabidopsis thaliana AP1...                      315      97.1    -1.7   -1.5   65.6  65.6

2: ref|NM_100188.1| Arabidopsis thaliana WD-...                      4550     13.9    -1.7   -1.5   10.1  27.8

3: ref|NM_100297.2| Arabidopsis thaliana XIB...                      336      13.5    -1.7   -1.5   10.1  20.9

4: ref|NM_128468.2| Arabidopsis thaliana ATG...                      2124     13.5    -1.7   -1.5   10.1  20.9

5: ref|NM_118081.3| Arabidopsis thaliana RNA...                      2615     -13.3   -1.7   -1.7   10.1  18.9

……

 

 

#####################################

#    Arguments used in MFEprimer    #

#####################################

   

Amplicons size range from: 0 bp to: 5000 bp

PPC cutoff value: 0.0

 

Below are some arguments used in BLASTN:

 

Expectation value: 10000

Word size: 7

 

 

Conclusion

The MFEprimer program is able to help user to identify potential non-specific amplifications for any primer sets, which is important before running a real PCR reaction.

 

 

 

References

Han, S. and Kim, D. (2006) AtRTPrimer: database for Arabidopsis genome-wide homogeneous and specific RT-PCR primer-pairs, BMC Bioinformatics, 7, 179-179.

Notredame, C., Higgins, D.G. and Heringa, J. (2000) T-Coffee: A novel method for fast and accurate multiple sequence alignment, Journal of Molecular Biology, 302, 205-217.

Rychlik, W. (1995) PRIMING EFFICIENCY IN PCR, Biotechniques, 18, 84-89.