====================================================================================================== = PSC - Primer Specificity Checking program for evaluating the primer specificity for PCR = = Ver 1.0 (April 2009). Copyright (C) Zhiyong Shen, Wubin Qu and Chenggang Zhang. All Rights Reserved. = ====================================================================================================== About this program: The PSC program is designed for evaluating PCR validity based on the primer matching ability with DNA template. PSC can predict most of the potential amplicons including the specific and non-specific PCR products by analyzing the primers before the PCR experiments. Either the primers for routine PCR or multiple primers for multiplex PCR could be analyzed by the PSC program in quite short time. About the "Database": All of the databases are downloaded from NCBI (ftp://ftp.ncbi.nih.gov). The user can select one or multiple databases at the same time to consider a mixed virtual database for analysis. During the development of PSC, we found that different source of databases will result different amplicons. Both the cDNA database and genomic DNA database (gDNA) are mounted in PSC. The serials of cDNA databases include RefSeq records, UniGene records and EST records, while the gDNA databases include chromosome sequence records and genome survey sequence (GSS) records. The mitochondrial genomic DNA sequence is merged in the gDNA database of the same species. Considering the large amount of databases (genomic, nt, est, etc) in NCBI, we do not suggest the user to run PSC on the whole nt or EST databases. To simplify this problem, we have divided the large database such as nt, gss to smaller ones according to different species. The user can thus select one or multiple databases at the same time to run a mixed virtual PCR or analysis. The naming rules for the databases are as followings (taken "Homo sapiens" as an example): H.sapiens_RefSeq: human subset of the RefSeq database H.sapiens_Chr: human subset of the Chromosome database H.sapiens_genomic: human subset of the refseq_genomic database Hs_uniGene_all: human subset of all of the UniGene sequences Hs_uniGene_uniq: human subset of the unique records of the UniGene sequences H.sapiens_nt: human subset of the nucleotide sequence database H.sapiens_gss: human subset of the Genome Survey Sequence (GSS) database H.sapiens_est: human subset of the Expressed Sequence Tag (EST) database H.sapiens_transcript: human subset of the genomic_transcript database We have also mounted three other databases below: Environmental_nt: Environmental nucleotide sequences Sequence Tag Site: The Sequence Tag Site (STS) database for electronic PCR (ePCR) analysis Patent_nt: Patent nucleotide sequence database for checking whether the gene was patented. About the "Word size": The word size is the most important parameter affecting the performance of PSC. It represents for the binding length of the PCR primer (counted from the 3'-end) with DNA template. Primers with at least three nucleotides at the 3'-end can extend successfully, which is an important reason for the non-specific PCR products. Taken an example below: 5' ATGCCCTAGCTTCCGGATG 3' (primer) ||||||||| 3' AAGGCCTACATTTAGCCTAGTTCATTTACGGTATGCCCTAGTAG 5' (template) There are 9 base pairs between the primer and template, which means that if the user select the word size = 9, PSC will report this potential non-specific PCR products. The less the word size was defined, the more the time of PSC will consume, and the possible number of non-specific products will increase rapidly. About the "Product Size Range": The product size range is defined from 0 bp to 100 kb. The user may choose the range to limit the number of non-specific PCR products. Default value is 0~5 kb. Implementation of PSC: PSC is based on the result of NCBI-Blast, so the parameter is closely related to the Blast program. We selected the version 2.2.15 of Blast as the best homology search program for PSC. Bugs reporting: PSC is always opened for the scientific community and under active development. Though this release has been tested and appeared to be stable, however, bugs may crop up. Any bug-reports, comments and suggestions are welcome to Chenggang Zhang to improve the performance of PSC for the world-wide PCR users. Zhiyong Shen, Wubin Qu & Chenggang Zhang 2009.03.31 22:11:06 ============================================== Chenggang Zhang, PhD, Professor and Director Department of Neurobiology Beijing Institute of Radiation Medicine Taiping Road 27, Beijing, 100850, China. Tel: +8610-66931590. Fax: +8610-68169574 Cell phone: +8610-13910133213 Email: zhangcg@bmi.ac.cn, zcgweb@126.com zcgweb@gmail.com, zcgweb@yahoo.com ==============================================